Home » Handball

Over 55.5 Goals handball predictions today (2025-12-14)

Unlock the Secrets of Handball Over 55.5 Goals

Handball enthusiasts, prepare to dive into the thrilling world of betting on over 55.5 goals in handball matches. Our platform offers you the latest updates on fresh matches, complete with expert betting predictions to guide your decisions. Whether you're a seasoned bettor or new to the game, our insights will help you navigate the dynamic landscape of handball betting with confidence.

Over 55.5 Goals predictions for 2025-12-14

No handball matches found matching your criteria.

Understanding Handball Over 55.5 Goals

In the realm of sports betting, predicting over 55.5 goals in a handball match is a popular and exciting market. This category appeals to those who anticipate high-scoring games, where both teams showcase their offensive prowess. By focusing on this specific betting line, you can capitalize on matches that promise intense action and plentiful scoring opportunities.

Key Factors Influencing High-Scoring Matches

  • Team Offense: Analyze the attacking capabilities of the teams involved. Teams with strong forwards and dynamic playmakers are more likely to contribute to high goal totals.
  • Defensive Weaknesses: Consider the defensive records of the teams. Teams with vulnerabilities in their defense may concede more goals, increasing the likelihood of surpassing the 55.5 goal threshold.
  • Match Intensity: High-stakes matches or rivalry games often see teams playing aggressively, leading to more scoring chances and higher goal counts.
  • Recent Form: Examine recent performances and head-to-head records. Teams in good form or with a history of high-scoring encounters against each other are prime candidates for over 55.5 goals.

Daily Match Updates and Expert Predictions

Stay ahead of the game with our daily updates on fresh handball matches. Our platform provides real-time information on upcoming games, ensuring you have access to the latest data for making informed betting decisions. Coupled with expert predictions, you can refine your strategy and increase your chances of success.

The Role of Expert Predictions

Our team of seasoned analysts brings years of experience to the table, offering insights that go beyond basic statistics. By considering factors such as team form, player injuries, and tactical approaches, our experts provide nuanced predictions that enhance your understanding of each match.

How to Utilize Expert Predictions

  1. Review Expert Analysis: Start by examining the detailed analysis provided by our experts for each match. Pay attention to their reasoning and the key factors they highlight.
  2. Compare Odds: Cross-reference expert predictions with current betting odds to identify value bets where the potential return outweighs the risk.
  3. Maintain Flexibility: Be prepared to adjust your bets based on new information or changes in team line-ups or conditions.
  4. Leverage Historical Data: Use historical data and past performance trends to validate expert predictions and refine your betting strategy.

Tips for Successful Betting on Over 55.5 Goals

Betting on over 55.5 goals requires a strategic approach and a keen understanding of handball dynamics. Here are some tips to help you make informed decisions and maximize your betting potential:

Analyze Team Matchups

Study how different teams match up against each other. Some combinations are known for producing high-scoring games due to their offensive strengths and defensive weaknesses.

Monitor Player Performance

Keep an eye on key players who have a significant impact on their team's scoring ability. Injuries or suspensions can drastically alter a team's performance and affect goal totals.

Consider Game Context

The context of the match—such as league position, playoff implications, or rivalry significance—can influence how teams approach the game, often leading to more aggressive play and higher scores.

Diversify Your Bets

To manage risk effectively, consider spreading your bets across multiple matches rather than placing all your money on a single game. This approach allows you to capitalize on different opportunities while minimizing potential losses.

Frequently Asked Questions

What is over 55.5 goals in handball?

In handball betting, "over 55.5 goals" refers to predicting that the combined total number of goals scored by both teams in a match will exceed 55.5. It's a popular market for those who expect high-scoring games.

How do I find expert predictions?

You can access expert predictions through our platform's daily updates section. Each match listing includes detailed analysis from our experts, providing insights into expected outcomes and key factors influencing the game.

What should I consider when betting on over goals?

When betting on over goals, consider team form, player availability, defensive capabilities, historical head-to-head results, and any external factors such as weather conditions or venue specifics that might impact gameplay.

Are there any tools available to help with betting?

Yes, our platform offers various tools such as statistical analyses, historical data charts, and real-time odds comparisons to assist bettors in making informed decisions.

Betting Strategies for Handball Over Goals

Value Betting

Finding value bets involves identifying scenarios where the odds offered by bookmakers do not accurately reflect the true probability of an event occurring. By leveraging expert predictions and statistical analysis, you can spot these opportunities and place bets that offer higher returns relative to their risk.

  • Analyze Market Trends: Keep track of how odds change leading up to a match to identify potential value bets as they develop.
  • Leverage Insider Knowledge: Use insights from expert predictions that may not yet be fully priced into the market by bookmakers.

Betting Staking Plans

1: # miR-199a-5P is involved in ischemia/reperfusion-induced apoptosis via targeting TRAF6 in rat cardiomyocytes 2: Author: Chao Wang, Zhong-hua Liang, Ying Liang 3: Date: 8-23-2019 4: Link: https://doi.org/10.1186/s13000-019-0851-y 5: Diagnostic Pathology: Research 6: ## Abstract 7: BackgroundIschemia/reperfusion (I/R) injury is one of major causes resulting in acute myocardial infarction (AMI). miR-199a-5P has been reported as an important role in multiple diseases including cancer; however its role in cardiac diseases remains unknown. 8: MethodsThe expression levels of miR-199a-5P were determined using quantitative real-time PCR (qRT-PCR). Cell apoptosis was measured using flow cytometry analysis after Annexin V-FITC/PI double staining; whereas cell viability was determined using CCK-8 assay. 9: ResultsmiR-199a-5P was significantly decreased in ischemic myocardial tissues compared with sham control group (P < 0.05), which was reversed by treatment with miR-199a-5P mimic; whereas miR-199a-5P inhibitor further decreased its expression levels (P < 0.05). Overexpression of miR-199a-5P reduced cell apoptosis induced by I/R injury (P < 0.05), whereas down-regulation increased cell apoptosis compared with NC group (P < 0.05). In addition, miR-199a-5P overexpression increased cell viability compared with NC group (P < 0.05), which was reversed by miR-199a-5P inhibitor treatment (P < 0.05). TRAF6 was identified as a target gene of miR-199a-5P; moreover luciferase reporter assay showed that miR-199a-5P mimic inhibited luciferase activity significantly (P < 0.05). Moreover TRAF6 overexpression partially abolished inhibitory effects induced by miR-199a-5P mimic. 10: ConclusionsThese results indicated that miR-199a-5P was involved in I/R-induced cardiomyocyte apoptosis via targeting TRAF6. 11: ## Background 12: Acute myocardial infarction (AMI) is one of major causes resulting in death worldwide [1]. Although rapid reperfusion therapy has been proved as an effective treatment for AMI patients [2], ischemia/reperfusion (I/R) injury still remains an important problem during treatment [1]. The underlying mechanisms involved in I/R-induced cardiomyocyte injury remain largely unknown; thus it is urgent for us to explore novel molecular targets involved in this process. 13: MicroRNAs (miRNAs) are small non-coding RNAs which regulate gene expression at post-transcriptional level [3]. Accumulating evidences have shown that dysregulation of microRNAs play important roles in various human diseases including cancers [4], cardiovascular diseases [5] as well as autoimmune diseases [6]. Recent studies have shown that some microRNAs are involved in regulating cardiomyocyte apoptosis induced by I/R injury [7]. For example, Yang et al., reported that miR‐21 regulates hypoxia/reoxygenation-induced apoptosis via targeting PDCD4 in H9c2 cells [8]; while another study showed that miR‐146b regulates hypoxia/reoxygenation-induced apoptosis via targeting PTEN/Akt pathway [9]. However whether other microRNAs are also involved in I/R-induced cardiomyocyte injury remains largely unknown. 14: Recently we identified miR‐199a‐5P as one important regulator involved in multiple diseases including cancer; however its role in cardiac diseases remains unclear [10]. In this study we aimed at investigating whether miR‐199a‐5P is involved in I/R-induced cardiomyocyte injury via regulating cell apoptosis. 15: ## Methods 16: ### Animals 17: Male Sprague-Dawley rats weighing approximately (180–200) g were purchased from Vital River Laboratory Animal Technology Co., Ltd., Beijing China (Certificate No.: SCXK(Jing)2016–0010). All animals were housed under standard conditions with free access to food and water at room temperature with humidity controlled at approximately (22–25) °C/50% humidity under a normal light/dark cycle (12 h/12 h). All animal experiments were performed according to National Institutes of Health Guide for Care and Use of Laboratory Animals; meanwhile all experimental protocols were approved by Animal Ethics Committee at Capital Medical University. 18: ### Rat model establishment 19: After anesthesia with intraperitoneal injection of sodium pentobarbital at dose rate of (30–40) mg/kg body weight; left anterior descending artery was ligated under direct vision according to previous description [11]. Sham group underwent similar surgical procedures except ligation. 20: ### Cell culture 21: Rat cardiomyocytes H9c2 cells were purchased from Procell Life Science & Technology Co., Ltd., Wuhan China; which were cultured under Dulbecco’s modified Eagle medium (DMEM) containing fetal bovine serum (FBS) supplemented with penicillin/streptomycin at concentration rate of (100 U/mL)/(100 mg/mL). 22: ### Cell transfection 23: To induce ischemia/reperfusion injury model ex vivo; H9c2 cells were cultured under hypoxia condition for duration time of (24 ± 1) h followed by reoxygenation for another duration time of (24 ± 1) h [12]. To investigate whether miR‐199a‐5P regulates cell apoptosis induced by ischemia/reperfusion injury; H9c2 cells were transfected using Lipofectamine®2000 transfection reagent according to manufacturer’s instructions at concentration rate of (50 nM); meanwhile negative control (NC), miRNA mimic/inhibitor or short hairpin RNA against TNF receptor associated factor 6 (TRAF6) were synthesized from GenePharma Co., Ltd., Shanghai China. 24: ### Quantitative real-time PCR 25: Total RNA from tissues or cells was isolated using TRIzol reagent according manufacturer’s instructions; then reverse transcription was performed using PrimeScript™ RT reagent Kit with gDNA Eraser kit according manufacturer’s instructions respectively; finally qRT‐PCR was performed using SYBR Premix Ex Taq II kit according manufacturer’s instructions on ABI PRISM®7900 Sequence Detection System instrument following protocol described previously [13]. The primers used for qRT‐PCR were listed as follows: 26: miR‐199a‐5P forward primer sequence: 27: GTGCAGGGTCCGAGGTATTC; 28: Reverse primer sequence: 29: GTGCAGGGTCCGAGGTATTT; 30: U6 forward primer sequence: 31: GCTTCGGCAGCACATATACTAAAAT; 32: Reverse primer sequence: 33: CGCTTCACGAATTTGCGTGTCAT; 34: TRAF6 forward primer sequence: 35: AAGGACAAACGGCCCAAGTA; 36: Reverse primer sequence: 37: TGGCGTCTTCTCGGTAGTGA; 38: GAPDH forward primer sequence: 39: CGCTCTCTGCTCCTCCTGTTC; 40: Reverse primer sequence: 41: ATCCGTTGACTCCGACCTTC. 42: Relative expression levels were calculated using comparative Ct method normalized against internal reference genes. 43: ### Luciferase reporter assay 44: Wild-type (WT) or mutant-type (MUT) fragments containing putative binding sites between TRAF6 mRNA (− 889/-826) and miR‐199a‐5P were amplified using PCR amplification; then cloned into pMIR-reporter vectors respectively followed by co-transfection into H9c2 cells using Lipofectamine®2000 transfection reagent according manufacturer’s instructions at concentration rate of (50 nM); finally luciferase activity was measured using Dual-Luciferase Reporter Assay System according manufacturer’s instructions after culture under hypoxia condition for duration time of (24 ± 1) h followed by reoxygenation for another duration time of (24 ± 1) h. 45: ### Western blot analysis 46: Total protein from tissues or cells was extracted using RIPA Lysis Buffer containing PMSF followed by measurement protein concentration using BCA kit according manufacturer’s instructions respectively; then proteins were separated using SDS-PAGE electrophoresis followed by transfer onto PVDF membranes which were incubated overnight at temperature rate (4 °C) with primary antibodies against TRAF6 or GAPDH respectively; finally proteins were incubated secondary antibodies conjugated with horseradish peroxidase at room temperature for duration time (1 h); then protein bands were visualized using ECL Western Blotting Substrate followed by measurement band intensity using ImageJ software version number (1·46r). 47: ### Flow cytometry analysis 48: Cells were harvested after transfection followed by staining using Annexin V-FITC/PI double staining Kit according manufacturer’s instructions; finally cell apoptosis rate was measured using flow cytometry analysis. 49: ### CCK‑8 assay 50: Cells viability was determined using CCK‑8 assay kit according manufacturer’s instructions after culture under hypoxia condition for duration time (24 ± 1 h) followed by reoxygenation for another duration time (24 ± 1 h). 51: ### Statistical analysis 52: All data from three independent experiments were expressed as mean values ± standard deviation; differences between groups were analyzed using one-way ANOVA followed by Tukey’s post hoc test using GraphPad Prism version number (7·02); P value less than 0·05 represented statistically significant differences between groups. 53: ## Results 54: ### Expression levels of miR‑199a‑5P are down-regulated during ischemia/reperfusion injury 55: Firstly we examined expression levels of miR‑199a‑5P during ischemia/reperfusion injury process ex vivo; results showed that expression levels of miR‑199a‑5P significantly decreased following ischemic treatment compared with sham control group; which could be reversed by treatment with miR‑199a‑5P mimic but further decreased following treatment with inhibitor instead (Fig. 1). 56: **Fig. 1**Expression levels of miR‑199a‑5P are down-regulated during ischemia/reperfusion injury process ex vivo*. # Compared with sham group (** P<0·05); ^ Compared with NC group (** P<0·05); ^^ Compared with NC group (** P<0·05) 57: ### Up-regulation of miR‑199a‑5P inhibits ischemia/reperfusion-induced cardiomyocyte apoptosis ex vivo 58: Secondly we investigated whether up-regulation of miR‑199a‑5P inhibits ischemia/reperfusion-induced cardiomyocyte apoptosis ex vivo; results showed that up-regulation significantly reduced cell apoptosis induced by ischemia/reperfusion injury compared with NC group (** P < 0·05); whereas down-regulation significantly increased cell apoptosis instead (* P < 0·05) (Fig. 2). 59: **Fig. 2**Up-regulation inhibits ischemia/reperfusion-induced cardiomyocyte apoptosis ex vivo*. # Compared with NC group (** P<0·05) 60: ### Up-regulation increases cell viability induced by ischemia/reperfusion injury ex vivo 61: Moreover we investigated whether up-regulation increases cell viability induced by ischemia/reperfusion injury ex vivo; results showed that up-regulation significantly increased cell viability compared with NC group (** P < 0·05); whereas down-regulation significantly decreased cell viability instead (* P < 0